ملف:Nussinov78 AF083069.1 1-43.svg

الملف الأصلي(ملف SVG، أبعاده 512 × 512 بكسل، حجم الملف: 24 كيلوبايت)

وصف قصير

Description Secondary structure of a maximal basepairing of a RNA subsequence of the Echovirus 5 genome (EMBL Accession number AF083069.1_1-43). This structure is predicted with the Nussinov 78 algorithm und is one of 42 optimal structures. The input sequence is "UUAAAACAGCCUGUGGGUUGCACCCACCCACAGGGCCCACUGG" and the dot-bracket string of the shown secondary structure is "(())..(.()(((((((((())...)))))))((()))(.)))". The image was created and exported with RNAMovies 2.04 as svg. To correct the margin it was edited with Inkscape.
Source Own work
Author Bgw

ترخيص


I, the copyright holder of this work, hereby publish it under the following licenses:
GFDL
يسمح بنسخ و توزيع و/أو تعديل هذا المستند وفق شروط رخصة الوثائق الحرة (جنو) إصدار 1.2 أو أي إصدار أحدث المنشورة من قبل مؤسسة البرمجيات الحرة بدون أقسام ثابته و نصوص الغلاف الأمامي و الخلفي.
[You may select the license of your choice.] Error: {{Lang}}: text has italic markup (help)

تاريخ الملف

اضغط على زمن/تاريخ لرؤية الملف كما بدا في هذا الزمن.

زمن/تاريخصورة مصغرةالأبعادمستخدمتعليق
حالي ★ مراجعة معتمدة
19:50، 15 ديسمبر 2023
تصغير للنسخة بتاريخ 19:50، 15 ديسمبر 2023512 × 512 (24 كيلوبايت)Pastakhov (نقاش | مساهمات)Upload https://upload.wikimedia.org/wikipedia/commons/6/6f/Nussinov78_AF083069.1_1-43.svg

لا يوجد صفحات تصل لهذه الصورة.

معلومات الصورة (ميتا)