معرض المتعلقات الشخصية للرسول، ص  *   7 مايو الأثيوبية المعارضة تؤكد اعتقال نائب رئيسها في صنعاء  *  بعد ساعات من العثور على جثث المستوطنين الثلاثة، إسرائيل تشن أكثر من 30 غارة على قطاع غزة  *   داعش تعلن الخلافة الإسلامية في مناطق من سوريا والعراق، والجيش العراقي يتقدم نحو تكريت  *   أكثر من 250 قتيل 90 مختطف في سلسلة هجمات لبوكو حرام على شمال شرق ووسط نيجريا  *   كيري: السيسي وعدني بإعادة تقييم قانون التظاهر وأحكام الإعدام.. وأكد على حماية حق التجمع السلمي  *   صينوك العملاقة في مفاوضات لشراء 30-40% من حقل أفروديت القبرصي من شركة نوبل إنرجي ودلك الإسرائيلية. لو اشترت الصين حصة في حقل أفروديت القبرصي الواقع في منطقة متنازع عليها مع مصر، فستكون نكسة هائلة لمصر على كافة الأصعدة  *  اليوم العالمي للهندسة المعمارية  *   كأس العالم: بلجيكا تتأهل إلى الربع النهائي بعد فوزها على الولايات المتحدة 2-1  *   حمل مجاناً من معرفة المخطوطات   *   هل انهارت مبادرة حوض النيل؟  *   ثروات مصر الضائعة في البحر المتوسط  *   شاهد أحدث التسجيلات  *  تابع المعرفة على فيسبوك  *  تابع مقال نائل الشافعي على جريدة الحياة: تطورات غاز المتوسط في أربع مشاهد  *      

تيلومير

Human chromosomes (grey) capped by telomeres (white)

التيلومير Telomere منطقة من تسلسل دناوي كثير التكرار يتوضع عند نهاية الصبغيات (الكروموسومات) chromosome تعمل تماما ك Aglet . الفائدة الرئيسية للتيلوميرات تظهر أثناء عملية تضاعف الدنا : ففي كل مرة تتضاعف بها الدنا يتوقف معقد الدنا بوليميراز قبل النهاية ببضعة مئات من الأسس النووية ، فلو كانت هذه التيلوميرات غير موجودة لحدث فقدان لمعلومات وراثية مهمة و ادى عن ذلك خلل كبير في عمل الخلايا الحية و منتجاتها البروتينية .

فهرست

إختبار للدم عن طول التيلوميرات يعطى مؤشرا لعمر الإنسان

اختبارات الدم التي تسعى لإخبار الناس عن عمرهم البيولوجي — ربما تقدم فكرة عن طول العمر، أو طول بقاءهم أصحاء أو مدى صحة أنها ستظل كذلك فترة من الزمن —هى الآن قيد الإعلان عن توافرها . لكن خلافا لمختلف التقارير الإعلامية الأخيرة،فإنه لا يمكن للاختبارات أن تحدد كم عدد الشهور أو السنين التى يمكن أن نتوقع أن يعيشها الإنسان. بعض الخبراء يقولون ان الاختبارات لن تقدم أي معلومات مفيدة بهذا الصدد.

الإختبارات تقيس طول التيلوميرات ,التى هى تراكيب على قمم الكروموسومات , وهي تغدوا قصيرة كلما تقدم العمر بالإنسان . وقد أظهرت دراسات مختلفة أن الناس الذين يتميزون بتيلوميرات قصيرة في خلايا الدم البيضاء هي أكثر عرضة لتطوير أمراض مثل السرطان وأمراض القلب ومرض الزهايمر، أو حتى الموت في وقت مبكر. وأشارت دراسات في الفئران أن التيلومير التى أمكن إطالتها تجعل حياتها أطول.

وبالتركيز على ذلك، فالمختبرات فى بداية تقديم اختبارات طول تيلوميرات شريط الحامض النووي، ووضع جدلا جديدا حول تلك الاختبارات الجينية التى ينبغي أن تقدم للجمهور وماذا ستكون الآثار الأخلاقية إذا تم استخدام النتائج من قبل أرباب العمل أو غيرهم.

بعض المختبرات التي تقدم الإختبارات تسعى للتأكيد على أن المقصود مجرد نتائج لرفع إشارة تحذير.

واضاف "اننا ننظر إليها على أنها نوع من دعوة لإيقاظ المريض والطبيب ليقول : أنت تعرف، أنك على مسار الشيخوخة بسرعة ،" وقال شايفر أوتو، نائب الرئيس للمبيعات والتسويق في مختبرات في SpectraCell هيوستن.التى تبيع الإختبار ب 250 دولارا

وبدأت الشركة في اسبانيا، واسمه الدعائى Life Length تبيع اختبار ب 500 € ($ 712)، التي تقول أنه يمكن أن نقول للناس عمرهم البيولوجي، والذى قد لا يتوافق مع العمر الزمني .

شركة أخرى ، Telome تيلوم هيلث في مينلو بارك بولاية كاليفورنيا ، تخطط للبدء في تقديم اختبار في وقت لاحق هذا العام يتكلف حوالي 200 $ وقد شاركت في تأسيسه إليزابث بلاكبرن Elizabeth Blackburn من جامعة ولاية كاليفورنيا, سان فرانسيسكو التى تقاسمت جائزة نوبل في 2009 عن الاكتشافات المتعلقة بالتيلومير.





Structure of parallel quadruplexes that can be formed by human telomeric DNA. Image created from NDB UD0017.

تقصير التلومير

Lagging strand during DNA replication



تعليق

مشكلة تضاعف النهاية

تنجم ما تسمى بمشكلة تضاعف النهاية عن عدم قدرة الآلية القائمة لمضاعفة الصبغيات على أداء العملية بصورة كاملة. فعندما تقوم الإنزيمات التي تعرف بإنزيمات بلمرة الدنا DNA polymerases بنسخ الخيطين الأصليين أو "الأبوين" parent للدنا الصبغي، فإنها تترك كلا من الخيطين "البنتيين" daughter الجديدين متقاصرين عند أحد الطرفين (عادة الطرف الموسوم 5+). فإذا لم تعوّض الخلايا هذا الزيغ في آلية التضاعف، فإن الصبغيات ستنكمش. فوجود التيلوميراز، وهو الإنزيم الذي يطيل التيلوميرات, اقتُرح في أوائل الثمانينات كحل لمشكلة تضاعف النهاية.

1 استنساخ الدنا الصبغي، الموضح تخطيطيا، يبدأ من مناطق تعرف بمناطق الأصل للتضاعف، والتي تنفصل عندها الخيوط الأبوية. يكون تركيب كل خيط بنتي مستمرا (الأسهم السوداء) على أحد جانبي المنطقة وغير مستمر (الأسهم الحمراء) على الجانب المضاد.




تعليق

تسلسلات التلومير

Some known telomere sequences
المجموعة العضية تكرارات تلوميرية (5' إلى 3' نحو النهاية)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous فطريات Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
پروتوزوا سوطية Ciliate Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
نباتات عليا Arabidopsis thaliana TTTAGGG
Green algae Chlamydomonas TTTTAGGG
حشرات Bombyx mori TTAGG
دودة اسطوانية Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

التيلوميراز والشيخوخة البشرية

في عام 1988 غادرت گريدر جامعة بيركلي إلى مختبر كولد سبرنگ هاربر، ولاحقا وجدت مجموعتنا وآخرون الإنزيم تيلوميراز في هَدْبِيّات مختلفة عن رباعية الغشاء وأيضا في الخميرة والضفادع والفئران. وفي عام 1989 اكتشف (من جامعة ييل)، ولأول مرة، وجود هذا الإنزيم في خط خلوي سرطاني بشري أي في خلايا خبيثة حُفِظَت لأجيال عديدة في أطباق المزارع الخلوية. واليوم اتضح أن الإنزيم تيلوميراز تقوم بتركيبه تقريبا كل الكائنات ذات الخلايا المُنَوّاة nucleated. قد يختلف التركيب الدقيق لهذا الإنزيم من نوع لآخر ولكن كل صورة تحتوي على قالب رنا متخصص للنوع الواحد لبناء المتكررات التيلوميرية.

والآن أصبحت أهمية الإنزيم تيلوميراز لكثير من الكائنات الوحيدة الخلية أمرا غير قابل للجدل. فمثل هذه الكائنات خالدة، أي أن بمقدورها الانقسام إلى ما لانهاية، باستثناء الحوادث أو ما ينحم عن تدخل الوراثيين في حياة هذه الكائنات. وكما أوضح <L-G. يو> من أعضاء المجموعة البحثية في بلاكبيرن، فإن رباعية الغشاء تحتاج إلى الإنزيم تيلوميراز لتحتفظ بخلودها. وعندما يتحور (يتبدل) هذا الإنزيم، تنكمش التيلوميرات وتفنى الخلايا. وقد بينت مجموعة بلاكبيرن، وغيرهم، في الخمائر yeasts أن الخلايا التي ينقصها الإنزيم تيلوميراز يحدث فيها تقاصر تيلوميري وتهلك. ولكن ما الدور الذي يلعبه الإنزيم تيلوميراز في الجسم البشري الذي يتكون من أعداد غفيرة من أنواع الخلايا والذي هو أكثر تعقدا من رباعية الغشاء والخمائر.

من المثير للدهشة أن كثيرا من الخلايا البشرية ينقصها التيلوميراز. اكتشفت گريدر وآخرون ذلك في أواخر الثمانينات عندما قاموا بجمع كل خيوط البحث معا والتي كان الباحثون في فيلادلفيا قد بدؤوها قبل ذلك بأكثر من 25 عاما. فقبل التسعينات، كان يعتقد أن الخلايا البشرية التي تتضاعف بالجسم يمكنها الانقسام إلى ما لانهاية. في ذلك الوقت، أوضح <L. هايفليك> ومعاونوه (في معهد ويستار) بما لا يقبل الشك أن هذا الاعتقاد غير صحيح. واليوم من المعروف أن الخلايا الجسدية (التي لا تشكل جزءا من النسيج التكاثري) المأخوذة من حديثي الولادة (الولدان) ستنقسم 80 إلى 90 مرة في المزرعة الخلوية في حين أن الخلايا المأخوذة من أفراد عمرهم 70 سنة من المرجح أن تنقسم 20 إلى 30 مرة فقط. فعندما تتوقف الخلايا البشرية القادرة على الانقسام عن التكاثر ـ أو وفقا لكلمات هايفليك تصبح "مسنة" فإنها تبدو مختلفة وتقوم بوظائفها بكفاءة أقل مما كانت تفعل في الشباب وبعد فترة تموت.

وفي السبعينات، ربط أحد العلماء الروس وهو <M .A. أولفنيكوف> هذا التوقف المبرمج لانقسام الخلية بمشكلة تضاعف النهاية end-replication مفترضا أن الخلايا الجسدية البشرية ربما لا تقوم بتصحيح التقاصر الصبغي الذي يحدث عندما تُضاعِف الخلية محتواها من الدنا. فربما الانقسام يقف عندما تتيقن الخلايا من أن صبغياتها صارت شديدة القصر. لم نكن على دراية بفكرة أولفنيكوف حتى عام 1988 عندما قام (الذي كان حينذاك في جامعة ماك ماستر) بإطلاع گريدر على هذه الفكرة. أثارت هذه الفكرة الفضول وقررت گريدر وهارلي ومعاونوهما النظر فيما إذا كانت الصبغيات تتقاصر مع الزمن في الخلايا البشرية. بالتأكيد، فقدت معظم الخلايا الجسدية الطبيعية التي اختبروها مقاطع من تيلوميراتها عند انقسامها في المزارع الخلوية، وهي علامة على عدم نشاط الإنزيم تيلوميراز. وبالمثل، وجدت هذه المجموعة من الباحثين ومجموعة<D.N. هاستي> من مجلس البحوث الطبية (MRC) في أدنبره، أن التيلوميرات في بعض النسج (الأنسجة) البشرية الطبيعية تنكمش مع تقدم الناس في العمر [زيادة في تأكيد ذلك، أوضح <J .H. كوك> (من مجلس البحوث الطبية) أن التيلوميرات ظلت سليمة في خلايا النسيج التكاثري]. وتشير هذه النتائج إلى أن الخلايا البشرية ربما تُحصي عدد مرات الانقسام بإحصاء عدد المتكررات التيلوميرية التي تفقدها وربما توقف انقسامها عندما يتدهور التيلومير إلى طول حرج. ولكن البرهان الأكيد على هذا الاحتمال لم يتم التوصل إليه بعد.

هل يكون اختزال التيلوميرات واختزال القدرة على إطالتها مع مرور الزمن سببا للشيخوخة البشرية؟ ربما لا يكون هذا هو السبب الرئيسي. وعلى أي حال، بمقدور الخلايا، عادة، الانقسام لمرات أكثر مما هو مطلوب في فترة حياة الإنسان. ومع ذلك، فإن الأداء الوظيفي للجسم الأكبر عمرا قد يختل أحيانا نتيجة أن بعض الخلايا أصبحت مسنة. فمثلا، التئام الجروح الموضعية يمكن أن يختل نتيجة اختزال عدد الخلايا المتاحة لبناء جلد جديد في موضع الجرح، كما أن اختزال بعض كريات الدم البيضاء يمكن أن يسهم في التدهور المناعي المرتبط بالشيخوخة. علاوة على ذلك، من المعروف أن تصلُّب الشرايين يحدث أساسا في المواضع التي تأذت (تضررت) فيها جُدُر الأوعية الدموية. من الواضح أن الخلايا في المواضع التي تتعرض للأذية المتكررة تستهلك في النهاية كل قدرتها التضاعفية بحيث تفشل الأوعية أخيرا في تعويض الخلايا المفقودة، عندها يصبح الأذى مستديما ويستقر تصلب الشرايين.


المصادر

قراءات اضافية

وصلات خارجية